COVID-19 LAMP Test Kit

INTENTIONAL PUBLIC DISCLOSURE

The information contained within this page is intentionally disclosed in lieu of an attempt at reserving intellectual property. All information provided below is free and open source to anyone with the properly regulated facilities who wishes to use it to fight Coronavirus (COVID-19).

Note: This is a page about developing a cheap diagnostic test and does not contain medical advice. Please visit the WHO website for medical advice on COVID-19. If you are experiencing serious COVID-19 symptoms, please call your local emergency number (e.g. 000, 911, etc.)

BioFoundry’s mission has always been to empower humanity through the free access of knowledge and the open-source production of essential medicines. The emergence of COVID-19 has created chaos in an already strained medical systems and exposed the limitations in global diagnostics throughput.

Source: https://www.nih.gov/news-events/news-releases/new-coronavirus-stable-hours-surfaces

While countries scramble to upscale their medical testing capabilities, this demand is quickly pushing the price for tests beyond many nations’ purchasing power. It may become necessary to develop reliable-alternative COVID-19 diagnostic tests that can provide proper testing to the developing world. Until a functional vaccine or cure is found, testing will be our most powerful tool for containing the spread of the disease. If governments continue to focus on testing within their national borders, we will fail to address the development of hotspots overseas and face an even longer chill in international trade and travel.

Reliable self-diagnostic test is yet to make its way into the hands of patients – forcing everyone to rely on an overburdened medical system with limited thermocyclers for diagnosis. In areas without access to quantitative thermocyclers, let alone the niche enzymes necessary to run a test in these devices, this challenge becomes insurmountable.

BioFoundry proposes the creation of cheap test kits for novel Coronavirus which can be used in place of RTqPCR or MRI scans. This would necessitate a top-bottom supply chain of the necessary enzymes and, ideally, would by thermocycler free, or at least remove the quantitative requirement.

How do we currently diagnose COVID-19?

The trick to detecting viruses is to amplify viral RNA by first converting it into DNA using an enzyme named “Reverse Transcriptase”. The DNA strands produced by this enzyme are known as complimentary DNA (cDNA). Generally, this is done using a quantitative thermocycler, which amplifies the DNA through heating and cooling while simultaneously observing the reaction to see at which stage exponential amplification occurs.

Microfluidic PCR, qPCR, RT-PCR & qRT-PCR_RT PCR one and two steps — Source: https://www.elveflow.com/microfluidic-reviews/general-microfluidics/microfluidic-pcr-qpcr-rtpcr/
Another really cool resource on advanced PCR techniques

China amazed the world with its portable MRI scanners and 20 minute diagnostic test that searched for specific structures within the lungs, but it’s far too late to start manufacturing enough of these to service the world’s population in time. They will likely also remain beyond the capacity of many governments to purchase en masse. They’re an excellent solution, but difficult to implement NOW.

How will the Open Source diagnostic kit work?

The open-source (OS) community proposes ditching the expensive capital equipment in favour of a reaction that requires only a set of biological and chemical reagents in a single tube that gives a reliable diagnosis. We are currently sourcing the reagents to replicate the experiments being shared within the community. BioFoundry proposes setting up the facilities to synthesise the required biological reagents at scale, while collaborating with our sister company Argent Scientific to source the required chemicals. We would then focus on producing cheap test kits to fill the diagnostic gap in Australia, before moving our focus to Africa and South-East Asia to help support their containment efforts as well.

Watch this video from New England Biolabs on how LAMP works.

Source: https://thebiologynotes.com/loop-mediated-isothermal-amplification-lamp/
Great resource to learn more about LAMP. I love LAMP.

Loop-mediated isothermal amplification (LAMP) is the primary methodology being proposed to solve this challenge. This link is just one of several publications already in this space, further boosted by a veritable flood of blog posts by contributing scientists. As we build out this resource, we will try to include as many references as we can to the work of these brilliant people.

We ask that you please don’t attempt to recreate these experiments unless your lab is fully authorised by the government. If you have permission from your relevant local authorities and are working on a LAMP diagnostic kit, you can add your data to our public google drive folder.

You can also view Biofoundry’s results and daily write up in this public google drive folder.

(If you can’t see the “I Love Lamp” Write Up, click this link afterwards

Step 1: Recreate the Diagnostic Test using a commercial LAMP kit and a positive control and the primers described in OS papers.

This is the stage we are currently at. We have reviewed the existing publications and have decided on a couple of interesting primer sets. To begin testing whether this will be an effective diagnosis, we have decided to use an NEB LAMP kit. This will not be a scalable method, but will help minimise the risk of variables while we test the protocol.
The major challenge we will face during Step 4 will be in scaling our own enzyme production to meet the standard of this kit. For now, we only need to discover quickly whether this protocol will work and be reliable as a diagnostic.

Alongside the kit we will also need primers specific to COVID-19. These are short fragments of DNA that are used in conjunction with the kit to produce DNA strands (amplicons) of a known size. The sequences of these primers and their amplicons are described below. But first, lets have a look at the sequence of the Coronavirus and where the amplicons will be located within the overall genome of COVID-19. All sequences are 5′ to 3′ and the images are courtesy of SnapGene’s software, a long term supporter of our lab.

Genome published: https://www.ncbi.nlm.nih.gov/nuccore/MT072688
Consensus sequence of 29,811 bp with no gap and high average coverage (>77,000×)

Note: The sequences shown are for the cDNA produced by the Reverse Transcription Polymerase. The original sequences inside the virus will be single-stranded RNA and all T’s will be substituted with U’s.

Primer Set 1:

F3 TGCTTCAGTCAGCTGATG
B3 TTAAATTGTCATCTTCGTCCTT
FIP TCAGTACTAGTGCCTGTGCCCACAATCGTTTTTAAACGGGT
BIP TCGTATACAGGGCTTTTGACATCTATCTTGGAAGCGACAACAA
Loop F CTGCACTTACACCGCAA
Loop B GTAGCTGGTTTTGCTAAATTCC

619 bp Amplicon: CTGCTAAAGCTTACAAAGATTATCTAGCTAGTGGGGGACAACCAATCACTAATTGTGTTAAGATGTTGTGTACACACACTGGTACTGGTCAGGCAATAACAGTTACACCG
GAAGCCAATATGGATCAAGAATCCTTTGGTGGTGCATCGTGTTGTCTGTACTGCCGTTGCCACATAGATCATCCAAATCCTAAAGGATTTTGTGACTTAAAAGGTAAGTATG
TACAAATACCTACAACTTGTGCTAATGACCCTGTGGGTTTTACACTTAAAAACACAGTCTGTACCGTCTGCGGTATGTGGAAAGGTTATGGCTGTAGTTGTGATCAACTCCG
CGAACCCATGCTTCAGTCAGCTGATGCACAATCGTTTTTAAACGGGTTTGCGGTGTAAGTGCAGCCCGTCTTACACCGTGCGGCACAGGCACTAGTACTGATGTCGTATACA
GGGCTTTTGACATCTACAATGATAAAGTAGCTGGTTTTGCTAAATTCCTAAAAACTAATTGTTGTCGCTTCCAAGAAAAGGACGAAGATGACAATTTAATTGATTCTTACT
TTGTAGTTAAGAGACACACTTTCTCTAACTACCAACATGAAGA AACAATTTATAATTTACTT

Primer Set 2: ORF1a-A

ORF1a-A-F3 CTGCACCTCATGGTCATGTT
ORF1a-A-B3 AGCTCGTCGCCTAAGTCAA
ORF1a-A-FIP GAGGGACAAGGACACCAAGTGTATGGTTGAGCTGGTAGCAGA
ORF1a-A-BIP CCAGTGGCTTACCGCAAGGTTTTAGATCGGCGCCGTAAC
ORF1a-A-LF CCGTACTGAATGCCTTCGAGT
ORF1a-A-LB TTCGTAAGAACGGTAATAAAGGAGC

ORF1a Amplicon: CCCTATGTGTTCATCAAACGTTCGGATGCTCGAACTGCACCTCATGGTCATGTTATGGTTGAGCTGGTAGCAGAACTCGAAGGCATTCAGTACGGTCGTAGTGGTGAGAC
ACTTGGTGTCCTTGTCCCTCATGTGGGCGAAATACCAGTGGCTTACCGCAAGGTTCTTCTTCGTAAGAACGGTAATAAAGGAGCTGGTGGCCATAGTTACGGCGCCGATCT
AAAGTCATTTGACTTAGGCGACGA GCTTGGCACTGATCCTTATGAAGA

Primer Set 3: GeneN-A

GeneN-A-F3 TGGCTACTACCGAAGAGCT
GeneN-A-B3 TGCAGCATTGTTAGCAGGAT
GeneN-A-FIP TCTGGCCCAGTTCCTAGGTAGTCCAGACGAATTCGTGGTGG
GeneN-A-BIP AGACGGCATCATATGGGTTGCACGGGTGCCAATGTGATCT
GeneN-A-LF GGACTGAGATCTTTCATTTTACCGT
GeneN-A-LB ACTGAGGGAGCCTTGAATACA

GeneN Amplicon: ATGACCAAATTGGCTACTACCGAAGAGCTACCAGACGAATTCGTGGTGGTGACGGTAAAATGAAAGATCTCAGTCCAAGATGGTATTTCTACTACCTAGGAACTGGGCCA
GAAGCTGGACTTCCCTATGGTGCTAACAAAGACGGCATCATATGGGTTGCAACTGAGGGAGCCTTGAATACACCAAAAGATCACATTGGCACCCGCAATCCTGCTAACAA
TGCTGCAATCGTGCTAC

Step 2: Confirm kit works with positive control. Attempt to source enzymes independent of commercial kit or synthesise in house. Move onto self experimentation.

Positive control is also “on the way” – I don’t want to overpromise when I’m not sure supply chains can deliver. We will see if it arrives in a timely fashion. We’ll post summaries of the labwork here once it starts (ETA: 25th)

Step 3: Seek out a collaboration with the government and a pathology clinic to test our diagnostic kit on a larger spread of the population.

If you know someone, please let them know about us!
We’re already in discussion with several groups at different levels of the Australian government.

Step 4: Scale production of diagnostic kits through the biosynthesis of requisite enzymes. Meet Australia’s diagnostic gap.
* section under construction*

This has long been a plan of Biofoundry, to synthesise these critical molecules with a cheap and open source platform. This would finally allow the decentralisation of the organic molecules industry that is 30 years overdue and the major reason for the testing shortage. In the meantime, we hope to ensure Australia has enough tests to be constantly monitoring the population for infected individuals.

According to the information on the NEB website, the contents of the kit are:

Reagent in NEB Kit	Is it OS? OS Alternatives?	Efficient & scalable in-house production methods;	External Suppliers
Isothermal Amplification Buffer:	1X Buffer Components 20 mM Tris-HCl – Yes 10 mM (NH₄)₂SO₄ – Yes 50 mM KCl – Yes 2 mM MgSO₄ -Yes 0.1% Tween® 20 – aka. polyoxyethylene sorbitan monolaurate pH 8.8 @ 25°C	Best to source chemicals or precursors from the chemical industry.	Our sister company Argent Scientific regularly orders all of these reagents from China. If an alternative supply chain is necessary, Australia has some domestic capacity for the production of these chemicals; Tris-HCl – mix from Tris base (expensive) and Hydrochloric Acid (much cheaper) (NH₄)₂SO₄ – MgSO₄ – cheap and easy to order Polyoxyethylene Sorbitan Monolaurate – harder to manufacture and order
dNTPs		Yes	Yes
Bst2.0 Warmstart Polymerase	No, Several alternatives, but might be able to sort out agreement with NEB to use their product.	Efficient and scalable by anyone with a bioreactor. Breweries can be used in a pinch to improve national capacity. Plenty of alternative open source polymerases that can be used in place of Bst2.0.	Polymerases are normally an easy purchase from suppliers, but are likely to be in short supply during the coming months. Potentially partner with UNSW or CSIRO to rapidly upscale production. Need a plasmid first.
WarmStart RTx Reverse Transcription Polymerase	No, Several alternatives, but might be able to sort out agreement with NEB to use their product.	Efficient and scalable by anyone with a bioreactor. Breweries can be used in a pinch to improve national capacity. There are some open source alternatives for open source RT polymerases, but less so than with regular polymerases.	RT-Polymerases are normally an easy purchase from suppliers, but are likely to be in short supply during the coming months. Potentially partner with UNSW or CSIRO to rapidly upscale production. Need a plasmid first.
Fluorescent Dye

This is just a basic summary of how a group could obtain the independent

Isothermal Amplification Buffer

dNTPs

Bst2.0 Warmstart Polymerase

Warmstart RTx Reverse Transcription Polymerase

Additional Materials and Equipment Required for Scaled Test Kit Production

Lb media, antibiotic, primers, positive control, pure water, sterile throat/nose swabs, heat block, bioreactors

Reagent/Equipment	Cost/X	Regular Method to Produce/Obtain	Alternative Method to Produce/Obtain
LB Media
Antibiotics
Pol Plasmid
RT Pol Plasmid
Primers
Positive Control
Purified Water
Sterile Nose/Throat Swabs

Our sister lab in Melbourne also has ambitious plans in this space. Head over their website to get in contact with Andrew if you’re interested in learning more.

Step 5: Limit testing and ongoing monitoring of kit effectiveness

This kit is useless if it gives false positives or false negatives. This will likely only be able to be determined through wide screen testing alongside a trusted diagnostic test like RTqPCR.

Step 6: Attempt to address diagnostic gap in hard-hit regions with low purchasing power. Attempt to subsidise expenses through purchasing-power based discretionary pricing.

If a vaccine is not developed and implemented in a miraculous period of time, containment of the disease overseas is likely to become of peak national security concern. As such we hope to leverage the Australian Government’s interest in containing the disease to help sell our diagnostic kits at an affordable price overseas. We are happy to consult with investors and the public sector about the ideal business model to effectively distribute this diagnostic test. While all our research will be OS, we must ensure we create an effective business model to achieve efficient distribution. What matters most right now is results.

Why Open-Source R&D?

It was the existing pharmaceutical infrastructure of intellectual property hoarding that left our species so poorly prepared for a pandemic like COVID-19. If we’re going to learn to survive in a future that may contain similar or worse pandemics, we’re going to need to redesign our system of rewarding innovation. Rather than accusing Chinese firms of intellectual property theft, the Western pharmaceutical industry should be building research collaborations. Likewise, the outdated scientific publishing industry slows the speed of innovation by charging researchers to publish their work behind paywalls. We believe that a solution to this crisis can only by achieved by the free and open sharing of scientific research.

Why Diagnosis? Why not work on a cure?

BioFoundry is only PC1. We are unable to handle pathogenic samples and could not countenance putting our wider community at risk. Instead we will obtain a positive control through proper channels and focus on testing. That said, the initial testing of human samples using our kit will likely require self-experimentation.

Who else are we working with?

OS-Coronavirus Discord Channel

Global MediXchange for Combating COVID-19

Sources and groups referenced while writing page: